BBa_K592003 1 BBa_K592003 PcpcG2 promoter, ccaR-regulated 2011-09-16T11:00:00Z 2015-05-08T01:12:48Z This sequence can be amplified from the genome of Synechocystis PCC6803. Reference: Hirose Y, Shimada T, Narikawa R, Katayama M, Ikeuchi M (2008) Cyanobacteriochrome CcaS is the green light receptor that induces the expression of phycobilisome linker protein. Proc Natl Acad Sci U S A 105: 9528-9533. The 238 bp sequence can be directly taken from the pJT122 plasmid designed by Jeffrey Tabor. Reference: Tabor, J. J., Levskaya, A., and Voigt, C. A. (2011). Multichromatic control of gene expression in Escherichia coli. J. Mol. Biol. 405, 2, 315???324. PcpcG2 is the green-light activated promoter from the genome of Synechocystis PCC6803. This 238 bp sequence is used by Jeffrey Tabor in pJT122 plasmid and contains the entire region upstream of cpcG2 and downstream of ccaR. PcpcG2 is regulated by the light-activation of ccaS/ccaR. The gene downstream to this promoter is transcribed upon activation by ccaS/ccaR, via green light. false false _763_ 0 7929 9 Not in stock false This sequence was PCR-amplified directly from the pJT122 plasmid provided by Chris Voigt, the co-author of Tabor's paper on multichromatic light-sensing (Tabor et al. 2011). Due to its nature, optimizing primers to extract this sequence from the source plasmid was difficult. Recommend touchdown-PCR. false Lei Sun annotation2130109 1 PcpcG2 promoter range2130109 1 1 238 BBa_K592003_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z