BBa_K592006 1 BBa_K592006 FixK2 promoter 2011-09-16T11:00:00Z 2015-05-08T01:12:48Z FixK2 promoter omes from the genome of Bradyrhizobium japonicum. Released HQ 2013 FixK2 promoter is the wild-type promoter to which phospho-FixJ binds. FixJ in turn can be regulated by YF1, the blue light-sensing protein. This promoter shows very little leaky activity in the absence of FixJ. false false _763_ 0 7929 9 In stock false The sequence information was provided by Moffat (Moffat et al. 2009). The DNA was synthesized by GenScript. false Lei Sun annotation2130179 1 FixK2 promoter range2130179 1 1 250 BBa_K592006_sequence 1 gccggagccgattatccgcacccgtccttggtcttggacacactcgctcgcgatccgaagccgcctttcaaagatactccgcagtgaaacgcatcttttaagcgcgacttgtcgccttcgcgcagcagaacactcgtatggcactcaatccatgatcgcttcgttcgctccgacgcgcgttgcggggcccccctcgaccggatgacaacacattgcgtcacctcaactgctgcgcgcgcactgcgtcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z