BBa_K592100 1 BFP Blue Fluorescent Protein (mTagBFP) 2011-09-19T11:00:00Z 2016-01-25T04:45:27Z Subach, O. M., I. S. Gundorov, et al. (2008). "Conversion of red fluorescent protein into a bright blue probe." Chem Biol 15(10): 1116-24. Released HQ 2013 This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a monomeric protein with a narrow fluorescence emission spectrum with a maximum at 456 nm. It has a tyrosine-based chromophore, giving it substantially higher brightness, faster chromophore maturation and higher pH stability than blue fluorescent proteins with a histidine in the chromophore. Subach et. al. started with a red fluorescent protein (TagRed) and converted it to a bright blue monomeric protein. See the article listed in source. The sequence has been codon optimized for expression in E coli by DNA 2.0. false false _763_ 4206 10137 9 In stock true The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2135490 1 mTagBFP range2135490 1 1 699 BBa_K592026 1 BBa_K592026 J23101-B0032-BFP 2011-09-20T11:00:00Z 2015-05-08T01:12:49Z The BFP part is <partinfo>BBa_K592100</partinfo> Released HQ 2013 Reference promoter <partinfo>BBa_J23101</partinfo> for testing the promoter strength coupled with BFP ((<partinfo>BBa_K592100</partinfo>)). Once this is cloned into pSB3K3 backbone one can measure the BFP output and use it as reference value to measure the promoter strength of other promoters. false false _763_ 0 7929 9 In stock false The BFP part (<partinfo>BBa_K592100</partinfo>) was codon-optimized for expression in E.coli by DNA2.0 false Lei Sun component2136727 1 BBa_B0032 component2136725 1 BBa_J23101 component2136730 1 BBa_K592100 annotation2136727 1 BBa_B0032 range2136727 1 44 56 annotation2136725 1 BBa_J23101 range2136725 1 1 35 annotation2136730 1 BBa_K592100 range2136730 1 63 767 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_B0032_sequence 1 tcacacaggaaag BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K592100_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa BBa_K592026_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagtcacacaggaaagtactagatgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z