BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K592008 1 PT5lac T5-lac Promoter 2011-09-10T11:00:00Z 2015-05-08T01:12:48Z Phage T5 Released HQ 2013 T5-lac promoter is a hybrid promoter made from the phage T5 early promoter and lac-operon. It contains three LacI binding sites and remains repressed in LacIq strains where LacI is expressed in high levels. It is inducible by IPTG, and recognizable by E.coli RNA polymerase. Compared to the T7 promoters, T5-lac promoter doesn't require the co-expression of phage polymerase. false false _763_ 0 7929 9 In stock false The most common DH5alpha and TOP10 used in assembly are not LacI-constitutive (LacIq) strains. Thus, any ORF placed downstream to this promoter will be massively transcribed. Therefore, it's recommended to employ low-copy number plasmids or even LacIq strains when adding genes to this promoter. false Erik Lundin annotation2135658 1 lacOi site range2135658 1 94 123 annotation2135657 1 lacO1 site range2135657 1 69 86 annotation2127135 1 T5-lac promoter range2127135 1 1 126 annotation2135659 1 -35 signal range2135659 1 63 68 annotation2135661 1 -10 signal range2135661 1 87 93 annotation2135656 1 lacO1 site range2135656 1 1 26 BBa_E0034 1 EYFP enhanced yellow fluorescent protein derived from A. victoria GFP 2004-06-06T11:00:00Z 2015-08-31T04:07:25Z Released HQ 2013 -- No description -- false false _11_1_ 0 61 7 In stock false true jcbraff annotation1245671 1 stop range1245671 1 757 762 annotation1245672 1 AAV range1245672 1 718 756 BBa_K592028 1 BBa_K592028 T5-lac promoter-B0032-YFP 2011-09-20T11:00:00Z 2015-05-08T01:12:49Z T5-lac promoter is a fusion protein with parts from the T5 phage promoter. The promoter T5-lac (<partinfo>BBa_K592008</partinfo>) tested for promoter strength coupled with YFP (<partinfo>BBa_E0034</partinfo>). This construct should be cloned into pSB3K3 plasmid to measure the YFP output and thereby determine the promoter strength. Theoretically, the promoter should be well-repressed in LacIq strain but inducible by high concentrations of IPTG. false false _763_ 0 7929 9 It's complicated false B0032 was picked as per standard. The part was assembled into pSB3K3 for testing and cloned into pSB1C3 for DNA submission. false Lei Sun component2136862 1 BBa_K592008 component2136868 1 BBa_E0034 component2136864 1 BBa_B0032 annotation2136864 1 BBa_B0032 range2136864 1 135 147 annotation2136868 1 BBa_E0034 range2136868 1 154 915 annotation2136862 1 BBa_K592008 range2136862 1 1 126 BBa_E0034_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctgctgctgtttaataa BBa_B0032_sequence 1 tcacacaggaaag BBa_K592028_sequence 1 tgtggaattgtgagcggataacaattacgagcttcatgcacagtgaaatcatgaaaaatttatttgctttgtgagcggataacaattataatatgtggaattgtgagcgctcacaattccacaacgtactagagtcacacaggaaagtactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctgctgctgtttaataa BBa_K592008_sequence 1 tgtggaattgtgagcggataacaattacgagcttcatgcacagtgaaatcatgaaaaatttatttgctttgtgagcggataacaattataatatgtggaattgtgagcgctcacaattccacaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z