BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K592003 1 BBa_K592003 PcpcG2 promoter, ccaR-regulated 2011-09-16T11:00:00Z 2015-05-08T01:12:48Z This sequence can be amplified from the genome of Synechocystis PCC6803. Reference: Hirose Y, Shimada T, Narikawa R, Katayama M, Ikeuchi M (2008) Cyanobacteriochrome CcaS is the green light receptor that induces the expression of phycobilisome linker protein. Proc Natl Acad Sci U S A 105: 9528-9533. The 238 bp sequence can be directly taken from the pJT122 plasmid designed by Jeffrey Tabor. Reference: Tabor, J. J., Levskaya, A., and Voigt, C. A. (2011). Multichromatic control of gene expression in Escherichia coli. J. Mol. Biol. 405, 2, 315???324. PcpcG2 is the green-light activated promoter from the genome of Synechocystis PCC6803. This 238 bp sequence is used by Jeffrey Tabor in pJT122 plasmid and contains the entire region upstream of cpcG2 and downstream of ccaR. PcpcG2 is regulated by the light-activation of ccaS/ccaR. The gene downstream to this promoter is transcribed upon activation by ccaS/ccaR, via green light. false false _763_ 0 7929 9 Not in stock false This sequence was PCR-amplified directly from the pJT122 plasmid provided by Chris Voigt, the co-author of Tabor's paper on multichromatic light-sensing (Tabor et al. 2011). Due to its nature, optimizing primers to extract this sequence from the source plasmid was difficult. Recommend touchdown-PCR. false Lei Sun annotation2130109 1 PcpcG2 promoter range2130109 1 1 238 BBa_K592029 1 BBa_K592029 PcpcG2-B0034-BFP green light sensor output 2011-09-20T11:00:00Z 2015-05-08T01:12:49Z PcpcG2: Synechocystis sp. PCC6803 Released HQ 2013 This construct is designed to enable a quantitative analysis of the CcaS/CcaR green light-sensing system. The output is BFP (<partinfo>BBa_K592100</partinfo>), which can be measured by e.g. FACS. false false _763_ 0 7929 9 In stock false This part is similar to <partinfo>BBa_K592019</partinfo> with BFP instead of amilGFP as output. While amilGFP is a good way to visualize, BFP is better for quantification. false Lei Sun component2136925 1 BBa_K592100 component2136921 1 BBa_K592003 component2136923 1 BBa_B0034 annotation2136923 1 BBa_B0034 range2136923 1 247 258 annotation2136925 1 BBa_K592100 range2136925 1 265 969 annotation2136921 1 BBa_K592003 range2136921 1 1 238 BBa_K592100 1 BFP Blue Fluorescent Protein (mTagBFP) 2011-09-19T11:00:00Z 2016-01-25T04:45:27Z Subach, O. M., I. S. Gundorov, et al. (2008). "Conversion of red fluorescent protein into a bright blue probe." Chem Biol 15(10): 1116-24. Released HQ 2013 This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a monomeric protein with a narrow fluorescence emission spectrum with a maximum at 456 nm. It has a tyrosine-based chromophore, giving it substantially higher brightness, faster chromophore maturation and higher pH stability than blue fluorescent proteins with a histidine in the chromophore. Subach et. al. started with a red fluorescent protein (TagRed) and converted it to a bright blue monomeric protein. See the article listed in source. The sequence has been codon optimized for expression in E coli by DNA 2.0. false false _763_ 4206 10137 9 In stock true The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2135490 1 mTagBFP range2135490 1 1 699 BBa_B0034_sequence 1 aaagaggagaaa BBa_K592029_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatcttactagagaaagaggagaaatactagatgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa BBa_K592003_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatct BBa_K592100_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z