BBa_E0034 1 EYFP enhanced yellow fluorescent protein derived from A. victoria GFP 2004-06-06T11:00:00Z 2015-08-31T04:07:25Z Released HQ 2013 -- No description -- false false _11_1_ 0 61 7 In stock false true jcbraff annotation1245672 1 AAV range1245672 1 718 756 annotation1245671 1 stop range1245671 1 757 762 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K592003 1 BBa_K592003 PcpcG2 promoter, ccaR-regulated 2011-09-16T11:00:00Z 2015-05-08T01:12:48Z This sequence can be amplified from the genome of Synechocystis PCC6803. Reference: Hirose Y, Shimada T, Narikawa R, Katayama M, Ikeuchi M (2008) Cyanobacteriochrome CcaS is the green light receptor that induces the expression of phycobilisome linker protein. Proc Natl Acad Sci U S A 105: 9528-9533. The 238 bp sequence can be directly taken from the pJT122 plasmid designed by Jeffrey Tabor. Reference: Tabor, J. J., Levskaya, A., and Voigt, C. A. (2011). Multichromatic control of gene expression in Escherichia coli. J. Mol. Biol. 405, 2, 315???324. PcpcG2 is the green-light activated promoter from the genome of Synechocystis PCC6803. This 238 bp sequence is used by Jeffrey Tabor in pJT122 plasmid and contains the entire region upstream of cpcG2 and downstream of ccaR. PcpcG2 is regulated by the light-activation of ccaS/ccaR. The gene downstream to this promoter is transcribed upon activation by ccaS/ccaR, via green light. false false _763_ 0 7929 9 Not in stock false This sequence was PCR-amplified directly from the pJT122 plasmid provided by Chris Voigt, the co-author of Tabor's paper on multichromatic light-sensing (Tabor et al. 2011). Due to its nature, optimizing primers to extract this sequence from the source plasmid was difficult. Recommend touchdown-PCR. false Lei Sun annotation2130109 1 PcpcG2 promoter range2130109 1 1 238 BBa_K592030 1 BBa_K592030 PcpcG2-B0034-YFP green light sensor output 2011-09-20T11:00:00Z 2015-05-08T01:12:49Z PcpcG2: Synechocystis sp. PCC6803 This construct is designed to enable a quantitative analysis of the CcaS/CcaR green light-sensing system. The output is YFP (<partinfo>BBa_E0034</partinfo>), which can be measured by e.g. FACS. false false _763_ 0 7929 9 It's complicated false This part is similar to <partinfo>BBa_K592019</partinfo> with YFP instead of amilGFP as output. While amilGFP is a good way to visualize, YFP is better for quantification. Furthermore, <partinfo>BBa_K592029</partinfo> serves the same purpose but has BFP instead. false Lei Sun component2136933 1 BBa_K592003 component2136938 1 BBa_E0034 component2136935 1 BBa_B0034 annotation2136938 1 BBa_E0034 range2136938 1 265 1026 annotation2136935 1 BBa_B0034 range2136935 1 247 258 annotation2136933 1 BBa_K592003 range2136933 1 1 238 BBa_E0034_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctgctgctgtttaataa BBa_K592030_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatcttactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctgctgctgtttaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K592003_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z