BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K592033 1 BBa_K592033 PcpcG2-B0034 2011-09-20T11:00:00Z 2015-05-08T01:12:49Z PcpcG2: Synechocystis sp. PCC6803. This is the output promoter to the CcaS/CcaR green light-sensing system with RBS. One can add any coding gene downstream to it in order to introduce control by green light. false false _763_ 0 7929 9 Not in stock false This construct is made to make it easy for users to just add any gene to the green light-sensing output. false Lei Sun component2137385 1 BBa_K592003 component2137387 1 BBa_B0034 annotation2137385 1 BBa_K592003 range2137385 1 1 238 annotation2137387 1 BBa_B0034 range2137387 1 247 258 BBa_K592003 1 BBa_K592003 PcpcG2 promoter, ccaR-regulated 2011-09-16T11:00:00Z 2015-05-08T01:12:48Z This sequence can be amplified from the genome of Synechocystis PCC6803. Reference: Hirose Y, Shimada T, Narikawa R, Katayama M, Ikeuchi M (2008) Cyanobacteriochrome CcaS is the green light receptor that induces the expression of phycobilisome linker protein. Proc Natl Acad Sci U S A 105: 9528-9533. The 238 bp sequence can be directly taken from the pJT122 plasmid designed by Jeffrey Tabor. Reference: Tabor, J. J., Levskaya, A., and Voigt, C. A. (2011). Multichromatic control of gene expression in Escherichia coli. J. Mol. Biol. 405, 2, 315???324. PcpcG2 is the green-light activated promoter from the genome of Synechocystis PCC6803. This 238 bp sequence is used by Jeffrey Tabor in pJT122 plasmid and contains the entire region upstream of cpcG2 and downstream of ccaR. PcpcG2 is regulated by the light-activation of ccaS/ccaR. The gene downstream to this promoter is transcribed upon activation by ccaS/ccaR, via green light. false false _763_ 0 7929 9 Not in stock false This sequence was PCR-amplified directly from the pJT122 plasmid provided by Chris Voigt, the co-author of Tabor's paper on multichromatic light-sensing (Tabor et al. 2011). Due to its nature, optimizing primers to extract this sequence from the source plasmid was difficult. Recommend touchdown-PCR. false Lei Sun annotation2130109 1 PcpcG2 promoter range2130109 1 1 238 BBa_B0034_sequence 1 aaagaggagaaa BBa_K592033_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatcttactagagaaagaggagaaa BBa_K592003_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z