BBa_K594003 1 sinR a luxR-type regulator from Sinorhizobium meliloti 1021 2011-09-30T11:00:00Z 2015-05-08T01:12:49Z this part is from the Sinorhizobium meliloti 1021 As the luxR, the sinR can bind with AHLS produced by sinI, and then promotes the expression of sinI, besides, the AHL((C16:1-HSL)is bound to ExpR, forming a complex required for the production of a symbiotically important exopolysaccharide, EPS II. The Rm1021 strain, which normally does not produce EPS II, has an insertion sequence that results in the disruption of expR (a luxR homologue). Strains proficient in EPS II production, such as Rm41 and Rm8530 (Rm1021 expR?), possess an intact expR gene. ExpR is a positive regulator of the exp genes, which are responsible for EPS II biosynthesis; however, it is unclear whether this regulatory effect is direct or indirect. false false _765_ 0 8221 9 It's complicated false NO false Yu Xiaoyan annotation2148050 1 sinR range2148050 1 1 738 BBa_K594003_sequence 1 atggctaatcaacaggctgtcctcaatttgctggatatcgtggaatatggaggttgcgcagaccccgagcgcttcttcgccctgatgcgtcgaaccttcaacatctcgcatctcctgtatctggaggcggagtctcttccggatggtttgagaatctgccgcctgcatcacactttcggcgcctacgccgccgaaatctacgccgccagggggctttacaggatcgacccgatcctcaagcttgcgctcggcggcgtcaggccggtggaatgggcgacagcgcggcgccgctttccggaatgcgagcccctcttcgaggcggccgaagaaatcgggctttccaccgaaggcgtggccttaccgctcccctcgcctgcgggccgcatggcgcttctcgcaatcggtgcaaacatgtcgccggttgagtggtccgcctaccgccgctgccatctgcgcgatttccagctggctgccaacctcttccacgcctccatgctcgaacattcggcgatggccggggcgctcgacgagcgcgatctccgcctgaccgggcgggaaacggaggtgctcacgtggtcggcggccggcaagagctactgggagatcgcaacgattctcggcatatccgagcgaacggtgcgtttcttcatgaccaatgcccgccgcaaactcaatgtagtgtccaacacgcaagctgtagcgcacgctgttcgacatgctctgatccccaccatctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z