BBa_K594005 1 rhiI a luxI homologous AHL synthetase from Rhzobium leguminosarum bv. vicae IMA57 2011-09-30T11:00:00Z 2015-05-08T01:12:49Z it is from the Rhzobium leguminosarum bv. vicae IMA57 we purchased from the CGMCC(China General Microbiological Culture Collection Center). Released HQ 2013 R. leguminosarum bv. viciae is a best characterized organism in the nitrogen-fixing rhizobia. Several quorum-sensing systems (rai, rhi, cin,and tra) have been identified and are intertwined in a complex regulatory network. The rhi system is composed of rhiR (a luxR homolog),rhiI (a luxI homolog), and the rhiABC operon, all of which are located on the symbiotic plasmid pRL1JI (29, 139). It was demonstrated that rhiABC was controlled by RhiR and that flavonoids repressed the expression of both rhiR and rhiABC. false false _765_ 0 8221 9 In stock false Initial experiments showed 3-OH-C14:1-HSL to be an inducer of the rhi genes, but later data showing that rhiI and rhiA could be induced by short-chain AHLs (C6-HSL, C8-HSL, and 3-oxo-C8-HSL) but not 3-OH-C14:1-HSL suggested that the induction was indirect. false Yu Xiaoyan annotation2148051 1 rhiI range2148051 1 1 552 BBa_K594005_sequence 1 atgatgaagatttgcattggggactctcgggctaacgccgtaatcatggagaaaatctggcggtttcgacaccagcaatttgtggaacgacgtggatggcaggcattacgcaagagtgacagacgggaaatagatcagtttgatcacgattgcgctattcattttagcgttctcaagaacgatgcggtgatcgggtattctcggctccttcctacggtgcagccgcatcttctttcaagcgtctacccgcaaatcatgcggggccaaaagtggccaaggtcgcacgacgttttcgaatggacgcggtgggcggttgcaagcggtgacgaaaggattgacggggttcgagtatcgcgggttttgatgatcgggttgatggagttttgccgcgttgccggcatcacctcgctcatcggcgagacgcacccaaagctgataaactccttgcgcgccaacgggtggcaaacacacatcctctcagagcccagcattttcgaaaacgaattagtcgtgccactcgaagtcatcccatcgtccgccccgcagacgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z