BBa_K594007 1 raiI a luxI homologous AHL synthetase from Rhzobium etli CFN 42 2011-09-30T11:00:00Z 2015-05-08T01:12:49Z This part is from Rhzobium etli CFN42. Released HQ 2013 RaiI is responsible for the synthesis of 3-OH-C8-HSL, a kind of AHL. The rai system in Rhzobium etli CFN42 can take the example of Rhizobium leguminosarum bv. vicae. RaiI is positively autoregulated by RaiR and 3-OH-C8-HSL but is also induced to a lesser extent by 3-OH-C14:1-HSL(produced by cinI) and 3-oxo-C8-HSL (produced by traI). These observations help explain the effect of cinRI mutations on the production of some of the short-chain AHLs and also suggest that an additional 3-oxo-C8-HSL-producing locus may contribute to regulation of raiRI. false false _765_ 0 8221 9 In stock false no false Yu Xiaoyan annotation2148105 1 raiI range2148105 1 1 639 BBa_K594007_sequence 1 atgttgcggatactcaccaaagacatgctcgagaccgatcgacgtgctttcgatgaaatgtttcgggctcgcgccgccgtttttcgcgatcggctgggatggcaggtcgatgtccgtgatcaatgggagagggaccgatatgacgaggccgaagatcccgtctatctcgtcacgcaacgaccttccggcacgctgacgggttcgctgcgcctgctgccgaccaccggagcgacgatgctcaaaagcgagttccggcatttcttcgatcagcctatcgacgtcgatagcccgacgacctgggaatgtacccgcttttgccttcatccgcatgccggacacatggagcaatcgcgcgcagtcgccacggagctgctctccgggctttgcgatcttgccctcgacaccggtatcgagagcattgtcggcgtctatgacgccgcgatggttgctgtgtaccgaaggatcggctggaggccgatgccgcttgcccgatcccggcccgagatcggcaagctgtatgttggcctatgggatgtgacggcggacaattgtcggacactgcgggccaacctgtaccggcttctcgagcaagcctctcccaatcctgccagagcccctgtcaatggtggcatgggatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z