BBa_K597102 1 BBa_K597102 VioA-AviTag [AviTagged violacein enzyme A] 2011-09-25T11:00:00Z 2015-05-08T01:12:50Z VioA Part:BBa_K274004 (Cambridge 2009, Distribution 2011) Ref: Balibar CJ, Walsh CT (2006). "In Vitro Biosynthesis of Violacein from l-Tryptophan by the Enzymes VioA−E from Chromobacterium violaceum." | Biochemistry Volume 45 Issue 51, Pages 15444-15457 Avitag: IDT DNA synthesized oligo single-stranded DNA annealed to form short double-stranded sequence. Ref: Cull MG, Schatz PJ (2000). ???Biotinylation of proteins in vivo and in vitro using small peptide tags.??? | Methods of Enzymology Vol 326, 2000, Pages 430-440. Avi-VioA codes for VioA with an appended biotinylation marker. When attached to a promoter, it can be biotinylated by E coii. E coli has a natural mechanism encoded by the BirA gene to produce biotin and biotinylate proteins - this mechanism can be enhanced by culturing with biotin. This enzyme can then be used in the violacein biosynthetic pathway with the added functionality of biotin-streptavidin binding. The VioA-avitag fusion protein was constructed to have the AviTag sequence on the C-terminus, followed by a stop codon. The resulting protein, once biotinylated, is capable of a ligand reaction with surface-coated avidin, while retaining the activity of VioA. The violacein biochemical pathway is composed of 5 enzmes, VioA-E. The violacein pathway involves five enzymes, VioA, VioB, VioC, VioD, and VioE, in the conversion of L-Tryptophan into a violacein, purple chromophore. However, only three of the five enzymes (VioA, VioB, and VioE) are required to produce a colored produce. Even with the exception of Vios C and D, L-Tryptophan is converted into prodeoxyviolacein, a green pigment. false false _769_ 0 10191 9 It's complicated false The avitag is capable of being on either the C or N terminus of the protein of interest with little difference between the two in the binding efficiency or expression of the protein. We chose to put the Avitag on the C-terminus for the convenience of using a primer dimer pair to insert the iGEM suffix to the sample from the parts registry. false James Mathew annotation2142957 1 AviTag range2142957 1 1267 1311 annotation2142958 1 Stop range2142958 1 1312 1314 annotation2142954 1 VioA range2142954 1 1 1254 annotation2142955 1 HindIII and SphI range2142955 1 1255 1266 annotation2142959 1 Start range2142959 1 1 3 BBa_K597102_sequence 1 atgaaacattcttccgatatctgcattgttggtgctggtatttctggtttgacgtgcgcaagccatctgctggacagcccggcatgccgtggtctgagcctgcgtatctttgacatgcagcaagaagccggtggccgtatccgcagcaaaatgctggatggtaaggcaagcattgaactgggcgcaggtcgctactcccctcagttgcacccgcatttccaaagcgcaatgcagcactatagccaaaagagcgaagtctatccgttcacccagttgaagttcaaatctcacgtgcagcaaaagctgaagcgcgccatgaatgaactgtccccgcgtctgaaagagcatggtaaagagagctttttgcagtttgtcagccgttatcaaggtcacgatagcgcggttggtatgatccgctctatgggttacgacgcactgttcctgccggatatcagcgcagaaatggcctacgacattgtgggtaagcacccggagatccagagcgtgacggacaacgacgcgaaccaatggtttgcagcggaaacgggctttgctggtctgattcagggcatcaaggctaaggttaaggcggcaggtgcgcgttttagcctgggttatcgtctgctgagcgtccgtaccgacggtgacggctacctgctgcaactggcaggtgacgacggctggaaactggagcaccgtacccgccatctgattctggcgattccgccgagcgcgatggcgggtttgaatgttgattttccagaagcctggtccggtgcgcgctatggcagcctgccgctgtttaagggctttctgacgtacggtgagccgtggtggttggactacaaactggacgatcaggtgctgattgttgacaacccgctgcgcaaaatctatttcaaaggcgataagtacctgttcttctataccgatagcgagatggcgaattactggcgcggttgtgtcgcggagggcgaggacggttacctggagcaaattcgcacccatttggctagcgcactgggtatcgtccgtgaacgtatcccgcaaccgctggcacacgttcacaagtattgggcgcacggcgttgagttttgccgtgattctgatattgaccacccgagcgcactgtctcatcgcgacagcggtatcatcgcgtgctccgatgcgtacacggagcattgtggttggatggagggcggtctgctgagcgcccgtgaggcaagccgtctgctgttgcagcgtatcgccgcgaagcttgcatgcggcctgaacgacatcttcgaggctcagaaaatcgaatggcacgaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z