BBa_K598003 1 BBa_K598003 TPP Down-regulated Hammerhead Ribozyme 2.5 with Native RBS 2011-09-26T11:00:00Z 2015-05-08T01:12:50Z E.coli Released HQ 2013 It's a basic part including only a ribozyme sequence numbered 2.5 false false _770_ 0 3541 9 In stock false Only use it by sites mutation false Yangyang ZHAO, Yan GONG annotation2152707 1 RBS range2152707 1 138 145 annotation2152899 1 TPP Ribozyme 2.5 range2152899 1 1 150 BBa_K598003_sequence 1 ttctccttcggtacatccagctgatgagtcccaaataggacgaaatcctcggggtgcccttctgcgtgaaggctgagaaatacccgtatcacctgatctggataatgccagcgtagggatggatcctggattccacgaaggagatatacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z