BBa_K598004 1 BBa_K598004 TPP Up-regulated Hammerhead Ribozyme 1.20 with Native RBS 2011-09-26T11:00:00Z 2015-05-08T01:12:50Z E.coli This is a basic part that only including a ribozyme numbered 1.20 false false _770_ 0 3541 9 It's complicated false Only use it by sites mutation false Yangyang ZHAO, Yan GONG annotation2152994 1 TPP Ribozyme 1.20 range2152994 1 1 150 annotation2144564 1 RBS range2144564 1 138 145 BBa_K598004_sequence 1 ttctccttcggtacatccagctgatgagtcccaaataggacgaaaacatcggggtgcccttctgcgtgaaggctgagaaatacccgtatcacctgatctggataatgccagcgtagggattattcctggattccacgaaggagatatacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z