BBa_K598006 1 BBa_K598006 Theophylline Responsive Riboswitch 1G1 with Engineered RBS 2011-09-26T11:00:00Z 2015-05-08T01:12:50Z By PCR. Released HQ 2013 It is a theophylline responsive riboswitch. false false _770_ 0 8816 9 In stock false Get this part only by PCR, rather than enzyme digestion. false Siyang HAO annotation2150230 1 Engineered RBS range2150230 1 75 81 annotation2152995 1 Theophylline responsive riboswitch Theo 1G1 range2152995 1 1 86 BBa_K598006_sequence 1 tccatgtatgttgatacttaatttaaagattaaacaaaagatgataccagccgaaaggcccttggcagctctcgaggaggtactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z