BBa_K602002 1 BBa_K602002 <i>Deinococcus radiodurans</i> PprM 2011-10-02T11:00:00Z 2015-05-08T01:12:50Z Obtained by PCR from genomic DNA. Regulatory protein acting downstream of PprI in the DNA damage response of <i>Deinococcus radiodurans</i>. Homolog of cold shock protein (Csp). false false _774_ 0 7851 9 In stock false We have designed part according to BBF RFC 54, which modifies the prefix and suffix to allow for the use of shorter PCR cloning primers but can be assembled in the usual way (i.e. Standard Assembly, RFC 10). false Toshiyuki Otake, Youfeng Lin, Shuhei Yasumoto, Takahiro Saka, Rie Takino, Shaothing Teoh annotation2151512 1 stop range2151512 1 400 405 annotation2151511 1 start range2151511 1 1 3 BBa_K602002_sequence 1 atgtgccgagtttcgattgttggtggcggtggcccctatcttgcctctcgttcaacaccagcagagaacttgaagggacatgccgggaaaagagcaacagcggcatgtggccttttgttggtgagagcaaggagatttgagatggcaactggaagagtgaagtggttcaacgcggaaaaaggcttcggctttatcgagacggaaggcagcgccgatgtattcgcgcactacagcgcgatcaactcctcgggcttccgcaagctcaacgaaggtgacgaagtcgagttcgaaattgaacccggtcagaacggcaaaggcccccaggccaagaacatcgtggtgaccaaggcagcccccgcgcccgcctatggtgaccgcccccgccgcgacgaccgctggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z