BBa_K606028 1 T7Term T7 polymerase terminator 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Registry J18913 T7 polymerase terminator. This is a copy of J18913, but in the sequence recorded, some parts of the sequence are missing. Here is the sequence de novo. false false _778_ 0 8998 9 Not in stock false See J18913 false Cyrille Pauthenier annotation2131877 1 J18913 T7ter range2131877 1 8 143 BBa_K606028_sequence 1 tggccggctagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggataccgggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z