BBa_K606037 1 BBa_K606037 ComS gene for the ComK/ComS system in B. Subtilis 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Extracted by PCR from B. Subtilis PY79 strain, and cloned in pSB1C3. This protein is the ComS protein from the ComS/ComK bistable system that control the competence in B. Subtilis during the late expodential phase. This gene is hided inside another gene (SfrA) so the sequence is not optimized. The same gene has been sequence optimized and synthetize by geneart. See the part K606038 false false _778_ 0 8998 9 It's complicated false The start and the stop codon had been changed for more standard codons in bacteria. This part is very small so it is very hard to clone. It is better to amplify it by PCR before moving it. false Cyrille Pauthenier annotation2138065 1 Stop range2138065 1 139 141 annotation2138064 1 ComS range2138064 1 1 138 BBa_K606037_sequence 1 atgaaccgatcaggcaagcatcttatcagcagcattatcctgtatccccggcccagcggagaatgtatatcctcaatcagcttggacaagcaaacacaagctacaacgtccccgctgtacttctgctggagggagaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z