BBa_K606038 1 BBa_K606038 ComS gene from the ComK/ComS system in B. Subtilis (codon optimized) 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Synthetize and codom optimized by GeneArt This protein is the ComS protein from the ComS/ComK bistable system that control the competence in B. Subtilis during the late expodential phase. This gene is hided inside another gene (SfrA) so the sequence is not optimized. The same gene has also been extracted from the chromosome. See the part K606038 false false _778_ 0 8998 9 It's complicated false Cloned from the GeneArt vector to pSB1C3 false Cyrille Pauthenier annotation2138066 1 ComS range2138066 1 1 138 annotation2138067 1 stop range2138067 1 139 141 BBa_K606038_sequence 1 atgaatagatcaggcaaacatctgatcagcagcattattctgtatccgcgtccgtcaggcgaatgcatttcatcaatttcactggataaacagacacaggcaacaacatcaccgctgtatttttgttggcgtgaaaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z