BBa_K606040 1 pHS Promoter Hyperspank B.subtilis & E.coli 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z inspired from the part BBa_K143015 Released HQ 2013 Promoter hyper-spank is an inducible promoter that has been designed for high expression in B.subtilis. Gene expression under the control of the promoter hyper-spank can be induced by addition of Isopropyl β-D-1-thiogalactopyranoside (IPTG). false false _778_ 0 8931 9 In stock false DNA synthesis false Axel S??guret annotation2138637 1 -35 range2138637 1 37 41 annotation2138638 1 -10 range2138638 1 60 65 annotation2138636 1 Lac0 range2138636 1 1 21 annotation2138639 1 LacO range2138639 1 72 92 BBa_K606040_sequence 1 aaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z