BBa_K606034 1 Y taRNA Tyrosine amber supressor tRNA 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Synthetize de novo by matching primers and cloned from the tRNA cluster of B. Subtilis genome of strain 168 Released HQ 2013 Tyrosine amber suppressor tRNA for B. Subtilis. false false _778_ 0 8998 9 In stock false This sequence is the pure tRNA without the side sequences false Cyrille Pauthenier BBa_K143053 1 Pveg-spoVG Promoter Pveg and RBS spoVG for B. subtilis 2008-10-07T11:00:00Z 2015-05-08T01:10:24Z Pveg-spoVG was synthesised by GeneArt Released HQ 2013 Constitutive promoter veg(<bbpart>BBa_K143012</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. Pveg-spoVG can be used in the context of a '''Ribosomes per second''' (RiPS) output generator '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false true _199_ 0 3475 9 In stock false The sequence of Pveg was obtained from the DBTBS<cite>1</cite> and RBS-spoVG were obtained from papers<cite>2</cite> and the sequence synthesised by GeneArt true Chris Hirst component1979395 1 BBa_K143012 component1979397 1 BBa_K143021 annotation1979397 1 BBa_K143021 range1979397 1 106 117 annotation1979395 1 BBa_K143012 range1979395 1 1 97 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_K606042 1 BBa_K606042 pVeg SpoVG Tyrosine amber supressor tRNA 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z B. subtilis Tyrosine amber supressor tRNA constitutively expressed in B. subtilis false false _778_ 0 8931 9 In stock false biobrick assembly false Axel S??guret component2159650 1 BBa_K143053 component2159651 1 BBa_K606034 annotation2159650 1 BBa_K143053 range2159650 1 1 117 annotation2159651 1 BBa_K606034 range2159651 1 126 210 BBa_K143053_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaa BBa_K606042_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagagggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccacca BBa_K143021_sequence 1 aaaggtggtgaa BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K606034_sequence 1 ggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z