BBa_K606049 1 BBa_K606049 Lambda phage attL recombination site 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z GeneArt de novo synthesis This sequence is the Attl recombination sequence from the lambda phage. It has been synthetized de novo by GeneArt. false false _778_ 0 8998 9 It's complicated false Cloned into pSB1C3 false Cyrille Pauthenier annotation2132628 1 O site range2132628 1 19 25 annotation2132651 1 P' site range2132651 1 26 106 annotation2132627 1 B site range2132627 1 1 18 annotation2132677 1 P2 range2132677 1 75 94 annotation2132676 1 H' range2132676 1 54 66 annotation2132652 1 Core range2132652 1 19 25 annotation2132653 1 Core right range2132653 1 27 32 BBa_K606049_sequence 1 tccgttgaagcctgcttttttatactaagttggcattataaaaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z