BBa_K606034 1 Y taRNA Tyrosine amber supressor tRNA 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Synthetize de novo by matching primers and cloned from the tRNA cluster of B. Subtilis genome of strain 168 Released HQ 2013 Tyrosine amber suppressor tRNA for B. Subtilis. false false _778_ 0 8998 9 In stock false This sequence is the pure tRNA without the side sequences false Cyrille Pauthenier BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K606053 1 BBa_K606053 Tyrosine amber supressor tRNA double terminator 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z b Released HQ 2013 Tyrosine amber suppressor tRNA for B. Subtilis and double terminator. false false _778_ 0 8931 9 In stock false biobrick assembly false Axel S??guret component2133134 1 BBa_K606034 component2133141 1 BBa_B0015 annotation2133141 1 BBa_B0015 range2133141 1 94 222 annotation2133134 1 BBa_K606034 range2133134 1 1 85 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K606053_sequence 1 ggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccaccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K606034_sequence 1 ggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z