BBa_K606056 1 BBa_K606056 Double terminator + Lambda phage attR recombination site 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z b Lambda phage attR recombination site false false _778_ 0 8931 9 It's complicated false DNA synthesis false Axel S??guret annotation2160565 1 Core right range2160565 1 285 300 annotation2160566 1 P range2160566 1 138 277 annotation2160556 1 B0015 - Double terminator range2160556 1 1 129 annotation2160563 1 Core left range2160563 1 271 276 annotation2160564 1 Core range2160564 1 278 284 annotation2160568 1 B' range2160568 1 285 300 annotation2160561 1 X2 range2160561 1 201 215 annotation2160559 1 P2 range2160559 1 169 178 annotation2160558 1 H1 range2160558 1 155 167 annotation2160567 1 O range2160567 1 278 284 annotation2160560 1 X1 range2160560 1 181 193 annotation2160562 1 H2 range2160562 1 233 245 annotation2160557 1 P1 range2160557 1 138 147 BBa_K606056_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaggtcactaataccatctaagtagttgattcatagtgactgcatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagcttttttatactaacttgagcgaaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z