BBa_K606034 1 Y taRNA Tyrosine amber supressor tRNA 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Synthetize de novo by matching primers and cloned from the tRNA cluster of B. Subtilis genome of strain 168 Released HQ 2013 Tyrosine amber suppressor tRNA for B. Subtilis. false false _778_ 0 8998 9 In stock false This sequence is the pure tRNA without the side sequences false Cyrille Pauthenier BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K606030 1 BBa_K606030 Pveg SpoVG RFPmCherry B0015 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Bacillus Subtilis RFPmcherry expression system in Bacillus subtilis false false _778_ 0 8931 9 It's complicated false biobrick assembly false Axel S??guret component2258753 1 BBa_E1010 component2258750 1 BBa_K143053 component2258760 1 BBa_B0015 annotation2258753 1 BBa_E1010 range2258753 1 124 829 annotation2258750 1 BBa_K143053 range2258750 1 1 117 annotation2258760 1 BBa_B0015 range2258760 1 838 966 BBa_K606065 1 tRNAAmbsys IPTG inducible tRNA Amber emitter with RFP monitor 2011-10-22T11:00:00Z 2015-05-08T01:12:51Z Synthetize de novo by matching primers and cloned from the tRNA cluster of B. Subtilis genome of strain 168 This device are the emitter system for our tRNA diffusion system. It express the tRNA amber who is needed for expression of T7 Amber. false false _778_ 0 8972 9 It's complicated false This sequence is the pure tRNA without the side sequences. This part was initially designed for B.subtillis but it also works in E.coli (look at our experience page BBa_K606034). false K??vin Yauy component2264400 1 BBa_K606030 component2264414 1 BBa_K606041 annotation2264400 1 BBa_K606030 range2264400 1 1 966 annotation2264414 1 BBa_K606041 range2264414 1 975 1296 BBa_K606040 1 pHS Promoter Hyperspank B.subtilis & E.coli 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z inspired from the part BBa_K143015 Released HQ 2013 Promoter hyper-spank is an inducible promoter that has been designed for high expression in B.subtilis. Gene expression under the control of the promoter hyper-spank can be induced by addition of Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). false false _778_ 0 8931 9 In stock false DNA synthesis false Axel S??guret annotation2138639 1 LacO range2138639 1 72 92 annotation2138636 1 Lac0 range2138636 1 1 21 annotation2138638 1 -10 range2138638 1 60 65 annotation2138637 1 -35 range2138637 1 37 41 BBa_K143053 1 Pveg-spoVG Promoter Pveg and RBS spoVG for B. subtilis 2008-10-07T11:00:00Z 2015-05-08T01:10:24Z Pveg-spoVG was synthesised by GeneArt Released HQ 2013 Constitutive promoter veg(<bbpart>BBa_K143012</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. Pveg-spoVG can be used in the context of a '''Ribosomes per second''' (RiPS) output generator '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false true _199_ 0 3475 9 In stock false The sequence of Pveg was obtained from the DBTBS<cite>1</cite> and RBS-spoVG were obtained from papers<cite>2</cite> and the sequence synthesised by GeneArt true Chris Hirst component1979395 1 BBa_K143012 component1979397 1 BBa_K143021 annotation1979395 1 BBa_K143012 range1979395 1 1 97 annotation1979397 1 BBa_K143021 range1979397 1 106 117 BBa_K606041 1 pHS-tRNAAm pHyperspank Tyrosine amber supressor tRNA double terminator 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z B. subtilis Released HQ 2013 Tyrosine amber supressor tRNA expression system induced by IPTG in presence of LacI false false _778_ 0 8931 9 In stock true biobrick assembly false Axel S??guret component2160449 1 BBa_K606034 component2160448 1 BBa_K606040 component2160456 1 BBa_B0015 annotation2160448 1 BBa_K606040 range2160448 1 1 92 annotation2160456 1 BBa_B0015 range2160456 1 194 322 annotation2160449 1 BBa_K606034 range2160449 1 101 185 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation2214014 1 Help:Barcodes range2214014 1 682 706 annotation1014044 1 mrfp1 range1014044 1 1 675 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K143053_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaa BBa_K143021_sequence 1 aaaggtggtgaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K606030_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K606040_sequence 1 aaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatt BBa_K606065_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatttactagagggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccaccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K606041_sequence 1 aaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatttactagagggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccaccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K606034_sequence 1 ggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z