BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_K143053 1 Pveg-spoVG Promoter Pveg and RBS spoVG for B. subtilis 2008-10-07T11:00:00Z 2015-05-08T01:10:24Z Pveg-spoVG was synthesised by GeneArt Released HQ 2013 Constitutive promoter veg(<bbpart>BBa_K143012</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. Pveg-spoVG can be used in the context of a '''Ribosomes per second''' (RiPS) output generator '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false true _199_ 0 3475 9 In stock false The sequence of Pveg was obtained from the DBTBS<cite>1</cite> and RBS-spoVG were obtained from papers<cite>2</cite> and the sequence synthesised by GeneArt true Chris Hirst component1979397 1 BBa_K143021 component1979395 1 BBa_K143012 annotation1979395 1 BBa_K143012 range1979395 1 1 97 annotation1979397 1 BBa_K143021 range1979397 1 106 117 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K606066 1 LacI-pHS-t Upstream LacI expression IPTG inducible tRNA emitter 2011-10-22T11:00:00Z 2015-05-08T01:12:51Z Synthetize de novo by matching primers and cloned from the tRNA cluster of B. Subtilis genome of strain 168 This device are the emitter system for our tRNA diffusion system. It express the tRNA amber who is needed for expression of T7 Amber. In addition a strong LacI expression cassette is added to repress pHyperspank because B. subtilis doesn't express LacI constitutively. false false _778_ 0 8972 9 It's complicated false This sequence is the pure tRNA without the side sequences. This part was initially designed for B.subtillis but it also works in E.coli (look at our experience page BBa_K606034). false K??vin Yauy component2224576 1 BBa_K606010 component2224590 1 BBa_K606041 annotation2224590 1 BBa_K606041 range2224590 1 1355 1676 annotation2224576 1 BBa_K606010 range2224576 1 1 1346 BBa_K143033 1 LacI LacI (Lva^-, N-terminal deletion) regulatory protein 2008-09-15T11:00:00Z 2015-05-08T01:10:24Z The LacI gene was cloned from''B. subtilis'' shuttle vector pDR111 using Pfu DNA polymerase PCR LacI is a regulatory protein responsible for the repression of many catabolite genes. Transcription is regulated by proteins which bind operator sequences around the transcription start site. These proteins can positively affect transcription (activators) or negatively affect transcription (reppresors). Some repressor proteins can be inactivted however by addition of an inducer, such as IPTG or certain sugars. LacI if the regulator protein for the lactose operon in ''E.coli'' and the hyper-spank protein of ''B. subtilis''<cite>#1</cite>(<bbpart>BBaK143015</bbpart>) and is responsible for ensuring that in the absence of lactose (or IPTG) that there is no expression trough these promoter. LacI is not endogenous to ''B. subtilis'', so LacI will need to be expressed in the host in order for the hyper-spank promoter to be regulated. In the presence of IPTG or lactose, the LacI tetramer is unable to bind DNA and so transcription resumes. This version of LacI lacks a Lva degradation tag and has a small(3 amino acid) N-terminal deletion relative to the current registry LacI (<bbpart>BBa_C0012</bbpart)> and is derivatives. The N-terminal deletion appears to be common to most of the LacI genes used in conjunction with ''B. subtilis'' though both forms are found in ''E.coli'' (in differing strains). LacI was used in conjunction with the '''Hyper-spank promoter''' (<bbpart>BBa_K143015<bbpart>) and acted as an input adaptor for a '''Polymerases per second''' (POPS) output ====References==== <biblio> #1 pmid=16166525 </biblio> false false _199_ 0 3475 9 It's complicated false LacI was located in the sequence of the ''B. subtilis'' shuttle vector pDR111. This version of LacI lacks a Ltva degradation sequence and has a small N-terminal deletion that is observed in many LacI used in studies on ''B.subtilis''. In particular, this LacI protein is used in pDR111 to regulate expression of the inducible Phyper-spank protein (<bbpart>BBa_K143015</bbpart>) (also used in the pDR111 vector). The BioBrick prefix and suffix were applied to the gene false Chris Hirst annotation1994271 1 stop range1994271 1 1081 1083 annotation1975974 1 LacI (Lva-, N-terminal deletion) regulatory protein range1975974 1 1 1080 annotation1994272 1 stop range1994272 1 1084 1086 annotation1992702 1 start range1992702 1 1 3 BBa_K606034 1 Y taRNA Tyrosine amber supressor tRNA 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z Synthetize de novo by matching primers and cloned from the tRNA cluster of B. Subtilis genome of strain 168 Released HQ 2013 Tyrosine amber suppressor tRNA for B. Subtilis. false false _778_ 0 8998 9 In stock false This sequence is the pure tRNA without the side sequences false Cyrille Pauthenier BBa_K143062 1 LacI-T LacI repressor protein - Terminator 2008-09-30T11:00:00Z 2015-05-08T01:10:24Z LacI was produced by PCR cloning using Pfu form the ''B. subtilis'' integration vector and cloned into a BioBrick with the registry double terminator. LacI transcriptional repressor protein (<bbpart>BBa_K143033</bbpart>) coupled to the double terminator (<bbpart>BBa_B0015</bbpart>. The LacI does not possess a LVA degradation tag and gas a short (3 amino acid) N-terminal deletion consistent with LacI used in conjunction with ''B. subtilis''. LacI can be used in conjunction with the lac operon promoter (<bbpart>BBa_K143015</bbpart>), where the LacI will act as a receiver for an IPTG input to result in a '''Polymerases per second''' (PoPS) output. The double terminator is the most commonly used terminator and is a combination of parts <bbpart>BBa_B0010</bbpart> and <bbpart>BBa_B0012</bbpart>. The double terminator allows the LacI to be easily incorporated into a closed transcriptional unit. false false _199_ 0 3475 9 It's complicated false LacI was identified from the pDR111 ''B. subtilis'' integration vector. The double terminator is the most commonly used registry terminator. false Chris Hirst component1994510 1 BBa_B0010 component1994512 1 BBa_B0012 component1994509 1 BBa_K143033 annotation1994509 1 BBa_K143033 range1994509 1 1 1086 annotation1994512 1 BBa_B0012 range1994512 1 1183 1223 annotation1994510 1 BBa_B0010 range1994510 1 1095 1174 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K606010 1 BBa_K606010 LacI strong expression casette for B. Subtilis 2011-07-06T11:00:00Z 2015-05-08T01:12:51Z This part comes from the already existing K143053 and K143062 biobricks This part is made to produce an expression of LacI in the B. Subtilis cell, in order to control the expression of the promoter pHyperSpank (K143055) level of expression. This is a sub-part of the IPTG inducible expression cassette K606011 for Bacillus Subtilis false false _778_ 0 8998 9 It's complicated false This is just the fusion of the two cassette. The system is in the pSB1C3 E. Coli cloning vector false Cyrille Pauthenier component2123112 1 BBa_K143062 component2123100 1 BBa_K143053 annotation2123112 1 BBa_K143062 range2123112 1 124 1346 annotation2123100 1 BBa_K143053 range2123100 1 1 117 BBa_K606041 1 pHS-tRNAAm pHyperspank Tyrosine amber supressor tRNA double terminator 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z B. subtilis Released HQ 2013 Tyrosine amber supressor tRNA expression system induced by IPTG in presence of LacI false false _778_ 0 8931 9 In stock true biobrick assembly false Axel S??guret component2160456 1 BBa_B0015 component2160449 1 BBa_K606034 component2160448 1 BBa_K606040 annotation2160448 1 BBa_K606040 range2160448 1 1 92 annotation2160456 1 BBa_B0015 range2160456 1 194 322 annotation2160449 1 BBa_K606034 range2160449 1 101 185 BBa_K606040 1 pHS Promoter Hyperspank B.subtilis & E.coli 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z inspired from the part BBa_K143015 Released HQ 2013 Promoter hyper-spank is an inducible promoter that has been designed for high expression in B.subtilis. Gene expression under the control of the promoter hyper-spank can be induced by addition of Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). false false _778_ 0 8931 9 In stock false DNA synthesis false Axel S??guret annotation2138637 1 -35 range2138637 1 37 41 annotation2138636 1 Lac0 range2138636 1 1 21 annotation2138638 1 -10 range2138638 1 60 65 annotation2138639 1 LacO range2138639 1 72 92 BBa_K143062_sequence 1 atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaaacggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K143033_sequence 1 atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaaacggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtaataa BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K606040_sequence 1 aaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatt BBa_K606034_sequence 1 ggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccacca BBa_K143053_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K143021_sequence 1 aaaggtggtgaa BBa_K606066_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaaacggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatttactagagggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccaccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K606010_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaaacggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K606041_sequence 1 aaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatttactagagggaggggtagcgaagtggctaaacgcggcggactctaaatccgctccctcagggttcggcagttcgaatctgcccccctccaccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z