BBa_K607015 1 BBa_K607015 cI 2011-09-17T11:00:00Z 2015-05-08T01:12:52Z 2011 distribution cI without degradation tag false true _779_ 0 9177 9 Not in stock false none false Olesja Popow BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369702 1 B0012 range369702 1 1 41 annotation369703 1 B0010 range369703 1 50 129 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_K607008 1 BBa_K607008 reverse lasB promoter 2011-09-15T11:00:00Z 2015-05-08T01:12:52Z 2011 distribution antisense reverse lasB promoter false false _779_ 0 9177 9 Not in stock false none false Olesja Popow annotation2132497 1 misc range2132497 1 1 101 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_I12006 1 Prm + Modified lamdba Prm promoter (repressed by 434 cI) 2004-07-13T11:00:00Z 2015-08-31T04:07:31Z Bushman(1993), Shih & Gussin (1983) Released HQ 2013 Lamdba Prm promoter modified to be activated by lamda repressor (cI) and repressed by 434 repressor (cI) false false _3_ 0 147 7 In stock false The O-R1 region of 434 contained 14 base pairs as opposed to the 17 base pairs of the O-R3 site of lambda. Also, it was noticed that the O-R3 site of the lambda included part of the -10 site. Hence, to preserve the spacing and the -10 site, the three nucleotides that were in both the -10 site and the lambda O-R3 site were retained. The 14 nucleotides that were in the O-R3 site and not in the -10 site were replaced with the O-R1 site of the 434. true mcnamara annotation786365 1 OR1 434 range786365 1 56 69 annotation786518 1 OR2 lambda range786518 1 33 49 annotation786500 1 OR1 lambda range786500 1 9 25 annotation837284 1 -35 range837284 1 48 53 annotation837228 1 -10 range837228 1 71 76 BBa_K607020 1 BBa_K607020 Prm_cI_antiPlasB with 0.3RBS 2011-09-17T11:00:00Z 2015-05-08T01:12:52Z 2011 distribution cI without degradation tag under transcriptional control of Prm promoter and reverse antisense lasB promoter, the RBS has a strength of 0.3 (obtained by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter). This construct represents an auto-inducing loop in which the Prm promoter drives expression of its own inducer cI. The running loop can be turned off by activating the reverse antisense lasB promoter (through LasR protein in the presence of Pseudomonas autoinducer (PAI)) false false _779_ 0 9177 9 It's complicated false We decided to keep PAI concentrations in the media constant (by adding N-(3-oxododecanoyl)homoserine lactone) and control the expression of LasR protein in order to achieve tight control of the reverse antisense lasB promoter. false Olesja Popow component2132641 1 BBa_K607015 component2132639 1 BBa_B0032 component2132637 1 BBa_I12006 component2132643 1 BBa_K607008 component2132631 1 BBa_B0025 component2132650 1 BBa_B0015 annotation2132637 1 BBa_I12006 range2132637 1 138 219 annotation2132650 1 BBa_B0015 range2132650 1 1075 1203 annotation2132641 1 BBa_K607015 range2132641 1 247 957 annotation2132643 1 BBa_K607008 range2132643 1 966 1066 annotation2132639 1 BBa_B0032 range2132639 1 228 240 annotation2132631 1 BBa_B0025 range2132631 1 1 129 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K607015_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggc BBa_K607008_sequence 1 gctttcgtgtaccaaaaagaacccgcggccaaacctgccagaactggcaggtagccttgatttcgccggaaatctgtatgttttcgctggaatagctagca BBa_K607020_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggtactagaggcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgttactagagtcacacaggaaagtactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctactagaggctttcgtgtaccaaaaagaacccgcggccaaacctgccagaactggcaggtagccttgatttcgccggaaatctgtatgttttcgctggaatagctagcatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0032_sequence 1 tcacacaggaaag BBa_I12006_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z