BBa_K608405 1 BBa_K608405 plastic binding domain 2011-09-13T11:00:00Z 2015-05-08T01:12:52Z phage During phage display experiments small sequences were found that bind to the polystyrene plastic surfaces of the used microtiter plates. The binding was strong enough to resist several washing steps. The sequence binds to plastic due to its high hydropathy. false false _780_ 0 9278 9 Not in stock false the gene product probably is toxic due to its high hydropathy. Its recommended to express it with an inducible promoter. false Sophie Cramer BBa_K608405_sequence 1 tggcatcgctggccgtggctggtgagcggct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z