BBa_K609002 1 BBa_K609002 human collagen type Ⅲ 2011-09-30T11:00:00Z 2015-05-08T01:12:53Z The collagen gene comes from the α1 chain of human collagen type Ⅲ (ColⅢ). And the signal peptide called blpC is found in Streptococcus thermophilus CNRZ1066. The gene contains a coding region encoding 101 amino acids, a signal peptide called blpC and a His tag. false false _781_ 0 8592 9 Not in stock false This part is designed for Streptococcus thermophilus to produce collagen. false Ke Liu annotation2148684 1 rcfB range2148684 1 31 189 annotation2148698 1 His tag range2148698 1 493 513 annotation2148688 1 collagen range2148688 1 190 492 BBa_K609002_sequence 1 gtttcttcgaattcgcggccgcttctagagatggctaacaatacgattaataactttgaaacacttgataaccacgctcttgaacaagtcgtaggtggaagtgggtggatggattatataaatggtttcctaaaaggattcggagggcaaagaacgcttccaacaaaagactataacattcctcaagttggtccacaaggtcttcaaggtcttccaggtactggtggtccaccaggtgaaaacggtaaaccaggtgaaccaggtccaaaaggtgacgctggtgctccaggtgctccaggtggtaaaggtgacgctggtgctccaggtgaacgtggtccaccaggtcttgctggtgctccaggtcttcgtggtggtgctggtccaccaggtccagaaggtggtaaaggtgctgctggtccaccaggtccaccaggtgctgctggtactccaggtcttcaaggtatgccaggtgaacgtggtggtcttggttcacaccaccaccaccaccactaatactagtagcggccgctgcaggaagaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z