BBa_K611008 1 BBa_K611008 R0040+B0034+E0040+B0015+I13453+B0034 2011-09-17T11:00:00Z 2015-05-08T01:12:53Z Built from existing parts in the registry though BioBrick assembly. Released HQ 2013 This part is used to characterize mutants of BBa_C0040 (TetR). By adding a mutant of BBa_C0040 after this part, one can measure several of its properties through its regulation of GFP expression. Concentration of the added TetR mutant can be varied through different arabinose concentrations as long as AraC is present. true false _783_ 0 10185 9 Discontinued false There is no terminator at the end, so the part needs to be used in a plasmid that has a terminator after the BioBrick suffix (such as pSB1A3 or pSB1C3). false Nicholas Csicsery annotation2133182 1 -10 range2133182 1 43 48 annotation2133180 1 -35 range2133180 1 20 25 annotation2133181 1 TetR 2 range2133181 1 26 44 annotation2133179 1 TetR 1 range2133179 1 1 19 annotation2133178 1 BBa_R0040 range2133178 1 1 54 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K611008_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z