BBa_K611021 1 BBa_K611021 LacI Promoter Variant #1 2011-09-18T11:00:00Z 2015-05-08T01:12:53Z Mutagenic PCR of BBa_R0010. Parts K611021 through K611027 are variants of the wild type LacI repressible promoter, BBa_R0010. These parts were generated through three rounds of mutagenic PCR and each have around 1 to 7 mutations. Each of these variants differ in properties such as transcriptional strength and repressor binding affinity and have been well characterized. This can be very useful in tuning genetic circuits for specific outputs. false false _783_ 0 10185 9 Not in stock false We chose to mutate this part from a well known promoter so that any changes in behavior would be easy to observe. false Nicholas Csicsery annotation2135633 1 t->c range2135633 1 176 176 annotation2135632 1 LacI binding site range2135632 1 166 200 annotation2135634 1 a->t range2135634 1 196 196 annotation2135629 1 -35 range2135629 1 137 142 annotation2135631 1 -10 range2135631 1 161 166 annotation2135624 1 t->a range2135624 1 37 37 annotation2135636 1 end of LacI coding region (inactive) range2135636 1 1 88 annotation2135635 1 start range2135635 1 173 173 annotation2135628 1 a->g range2135628 1 108 108 annotation2135626 1 CAP binding site range2135626 1 89 126 annotation2135630 1 t->c range2135630 1 151 151 annotation2135625 1 a->g range2135625 1 40 40 annotation2135627 1 a->g range2135627 1 103 103 BBa_K611021_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgaatcgttaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattagtgtgggttagctcactcattaggcaccccaggctttacactttatgcctccggctcgtatgttgtgtggaatcgtgagcggataacaatttctcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z