BBa_K611022 1 BBa_K611022 LacI Promoter Variant #2 2011-09-18T11:00:00Z 2015-05-08T01:12:53Z Mutagenic PCR of BBa_R0010. Parts K611021 through K611027 are variants of the wild type LacI repressible promoter, BBa_R0010. These parts were generated through three rounds of mutagenic PCR and each have around 1 to 7 mutations. Each of these variants differ in properties such as transcriptional strength and repressor binding affinity and have been well characterized. This can be very useful in tuning genetic circuits for specific outputs. false false _783_ 0 10185 9 Not in stock false We chose to mutate this part from a well known promoter so that any changes in behavior would be easy to observe. false Nicholas Csicsery annotation2135639 1 end of LacI coding region (inactive) range2135639 1 1 88 annotation2135642 1 -10 range2135642 1 161 166 annotation2135641 1 -35 range2135641 1 137 142 annotation2134889 1 a->t range2134889 1 103 103 annotation2135643 1 start range2135643 1 173 173 annotation2134891 1 LacI binding site range2134891 1 166 200 annotation2134890 1 a->g range2134890 1 198 198 annotation2135640 1 CAP binding site range2135640 1 89 126 BBa_K611022_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattattgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z