BBa_K611023 1 BBa_K611023 LacI Promoter Variant #3 2011-09-18T11:00:00Z 2015-05-08T01:12:53Z Mutagenic PCR of BBa_R0010. Parts K611021 through K611027 are variants of the wild type LacI repressible promoter, BBa_R0010. These parts were generated through three rounds of mutagenic PCR and each have around 1 to 7 mutations. Each of these variants differ in properties such as transcriptional strength and repressor binding affinity and have been well characterized. This can be very useful in tuning genetic circuits for specific outputs. false false _783_ 0 10185 9 It's complicated false We chose to mutate this part from a well known promoter so that any changes in behavior would be easy to observe. false Nicholas Csicsery annotation2135646 1 end of LacI coding region (inactive) range2135646 1 1 88 annotation2135648 1 -35 range2135648 1 137 142 annotation2134893 1 t->a range2134893 1 148 148 annotation2134894 1 LacI binding site range2134894 1 166 200 annotation2134892 1 t->a range2134892 1 104 104 annotation2135647 1 CAP binding site range2135647 1 89 126 annotation2135650 1 start range2135650 1 173 173 annotation2135649 1 -10 range2135649 1 161 166 BBa_K611023_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaaagtgagttagctcactcattaggcaccccaggctttacactttaagcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z