BBa_K611025 1 BBa_K611025 LacI Promoter Variant #5 2011-09-18T11:00:00Z 2015-05-08T01:12:53Z Mutagenic PCR of BBa_R0010. Released HQ 2013 Parts K611021 through K611027 are variants of the wild type LacI repressible promoter, BBa_R0010. These parts were generated through three rounds of mutagenic PCR and each have around 1 to 7 mutations. Each of these variants differ in properties such as transcriptional strength and repressor binding affinity and have been well characterized. This can be very useful in tuning genetic circuits for specific outputs. false false _783_ 0 10185 9 In stock false We chose to mutate this part from a well known promoter so that any changes in behavior would be easy to observe. false Nicholas Csicsery annotation2136215 1 start range2136215 1 173 173 annotation2134900 1 a->c range2134900 1 117 117 annotation2136212 1 CAP binding site range2136212 1 89 126 annotation2136214 1 -10 range2136214 1 161 166 annotation2134902 1 LacI binding site range2134902 1 166 200 annotation2136211 1 end of LacI coding region (inactive) range2136211 1 1 88 annotation2136213 1 -35 range2136213 1 137 142 annotation2134899 1 t->c range2134899 1 30 30 annotation2134901 1 t->c range2134901 1 123 123 BBa_K611025_sequence 1 caatacgcaaaccgcctctccccgcgcgtcggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctccctcatcaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z