BBa_K611026 1 BBa_K611026 LacI Promoter Variant #6 2011-09-18T11:00:00Z 2015-05-08T01:12:53Z Mutagenic PCR of BBa_R0010. Released HQ 2013 Parts K611021 through K611027 are variants of the wild type LacI repressible promoter, BBa_R0010. These parts were generated through three rounds of mutagenic PCR and each have around 1 to 7 mutations. Each of these variants differ in properties such as transcriptional strength and repressor binding affinity and have been well characterized. This can be very useful in tuning genetic circuits for specific outputs. false false _783_ 0 10185 9 In stock false We chose to mutate this part from a well known promoter so that any changes in behavior would be easy to observe. false Nicholas Csicsery annotation2134962 1 t->c range2134962 1 138 138 annotation2136220 1 start range2136220 1 173 173 annotation2136216 1 end of LacI coding region (inactive) range2136216 1 1 88 annotation2136217 1 CAP binding site range2136217 1 89 126 annotation2134964 1 LacI binding site range2134964 1 166 200 annotation2136219 1 -10 range2136219 1 161 166 annotation2134963 1 c->t range2134963 1 159 159 annotation2136218 1 -35 range2136218 1 137 142 BBa_K611026_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctctacactttatgcttccggcttgtatgttgtgtggaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z