BBa_K611027 1 BBa_K611027 LacI Promoter Variant #7 2011-09-18T11:00:00Z 2015-05-08T01:12:53Z Mutagenic PCR of BBa_R0010. Parts K611021 through K611027 are variants of the wild type LacI repressible promoter, BBa_R0010. These parts were generated through three rounds of mutagenic PCR and each have around 1 to 7 mutations. Each of these variants differ in properties such as transcriptional strength and repressor binding affinity and have been well characterized. This can be very useful in tuning genetic circuits for specific outputs. false false _783_ 0 10185 9 Not in stock false We chose to mutate this part from a well known promoter so that any changes in behavior would be easy to observe. false Nicholas Csicsery annotation2134968 1 LacI binding site range2134968 1 166 200 annotation2136225 1 start range2136225 1 173 173 annotation2134967 1 a->t range2134967 1 188 188 annotation2136221 1 end of LacI coding region (inactive) range2136221 1 1 88 annotation2136222 1 CAP binding site range2136222 1 89 126 annotation2134966 1 t->a range2134966 1 166 166 annotation2136224 1 -10 range2136224 1 161 166 annotation2134965 1 a->g range2134965 1 44 44 annotation2136223 1 -35 range2136223 1 137 142 BBa_K611027_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattagtgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgtagtgtggaattgtgagcggatatcaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z