BBa_K611049 1 BBa_K611049 pTet Variant #9 2011-09-26T11:00:00Z 2015-05-08T01:12:53Z Mutagenic PCR of the Tet repressible promoter, R0040. Parts K614021 through K614029 are variants of the wild type Tet repressible promoter, R0040. These parts were generated through three rounds of mutagenic PCR. Each of these variants differ in properties such as transcriptional strength and repressor binding affinity and have been well characterized. This can be very useful in tuning genetic circuits for specific outputs. These parts were characterized using K611012. false false _783_ 0 10185 9 Not in stock false This part does not have a termination sequence at the end. It is recommended that for optimal results, this part be used in a backbone that includes a terminator (such as pSB1C3). false Nicholas Csicsery annotation2143849 1 TetR 2 range2143849 1 26 42 annotation2143850 1 -35 range2143850 1 20 25 annotation2143830 1 TetR 1 range2143830 1 1 19 annotation2143817 1 t->c range2143817 1 45 45 annotation2143851 1 -10 range2143851 1 43 48 BBa_K611049_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagacactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z