BBa_K611092 1 BBa_K611092 B Truncation of BBa_C0051 2012-05-15T11:00:00Z 2015-05-08T01:12:54Z Parts Registry This part is a truncated version of BBa_C0051. The first 431 bases were truncated leaving a 319 base pair, non-functional coding region. This was designed to rule out any protein interaction with the promoter activity of the barcode region of BBa_C0051. false false _783_ 0 4722 415 Not in stock false none false Timothy Fenton annotation2175646 1 B Truncation range2175646 1 1 319 annotation2175750 1 Barcode range2175750 1 320 344 BBa_K611092_sequence 1 tgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z