BBa_K611093 1 BBa_K611093 A Truncation of BBa_C0051 2012-05-16T11:00:00Z 2015-05-08T01:12:54Z Parts Registry This part is a truncated version of BBa_C0051. The first 560 bases were truncated leaving a 190 base pair, non-functional coding region. This was designed to rule out any protein interaction with the promoter activity of the barcode region of BBa_C0051. false false _783_ 0 4722 415 Not in stock false none false Timothy Fenton annotation2175666 1 A Truncation range2175666 1 1 215 annotation2175667 1 Barcode range2175667 1 191 215 BBa_K611093_sequence 1 tgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z