BBa_K611094 1 BBa_K611094 Barcode 2012-05-16T11:00:00Z 2015-05-08T01:12:54Z Parts Registry This part is only the barcode which is added to some parts. This specific sequence is the version where the CXC pattern on each end of the barcode has base G (in place of the X). This part was used to see if the barcode alone was acting as a putative promoter when placed upstream of an RBS (BBa_B0034) and RFP (BBa_E1010). false false _783_ 0 4722 415 Not in stock false none false Timothy Fenton annotation2175771 1 Barcode range2175771 1 1 25 BBa_K611094_sequence 1 cgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z