BBa_K611096 1 BBa_K611096 Truncated LVA (5' -22bp) Tag with Double Stop Codon and Barcode 2012-05-16T11:00:00Z 2015-05-08T01:12:54Z Parts Registry This is a truncated version of the LVA Degradation Tag-TAATAA Double Stop Codon-Barcode region. The first 22 5' bases have been truncated from the LVA tag in order to pinpoint where promoter activity is originating from in the LVA-TAATAA-Barcode region. This is part of 8 truncation combinations of this region. false false _783_ 0 4722 415 Not in stock false none false Timothy Fenton annotation2175833 1 LVA 5' -22bp range2175833 1 1 11 annotation2175834 1 Barcode range2175834 1 18 42 BBa_K611096_sequence 1 ctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z