BBa_K611099 1 BBa_K611099 Truncated LVA (5' -11bp) Tag with Double Stop Codon and Truncated Barcode (3' -8bp) 2012-05-16T11:00:00Z 2015-05-08T01:12:54Z Parts Registry This is a truncated version of the LVA Degradation Tag-TAATAA Double Stop Codon-Barcode region. The first 11 bases have been truncated from the LVA tag and the last 8 3' bases have been truncated from the Barcode in order to pinpoint where promoter activity is originating from in the LVA-TAATAA-Barcode region. This is part of 8 truncation combinations of this region. false false _783_ 0 4722 415 Not in stock false none false Timothy Fenton annotation2175899 1 LVA (5' -11bp) range2175899 1 1 22 annotation2175900 1 Barcode (3' -8bp) range2175900 1 29 45 BBa_K611099_sequence 1 cgaaaactacgctttagtagcttaataacgctgatagtgctagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z