BBa_K611102 1 BBa_K611102 Truncated LVA (5' -22bp) Tag with Double Stop Codon and Truncated Barcode (3' -16bp) 2012-05-16T11:00:00Z 2015-05-08T01:12:54Z Parts Registry This is a truncated version of the LVA Degradation Tag-TAATAA Double Stop Codon-Barcode region. The first 22 bases have been truncated from the LVA tag and the last 16 3' bases have been truncated from the Barcode in order to pinpoint where promoter activity is originating from in the LVA-TAATAA-Barcode region. This is part of 8 truncation combinations of this region. false false _783_ 0 4722 415 Not in stock false none false Timothy Fenton annotation2175969 1 Barcode (3' -16bp) range2175969 1 18 26 annotation2175968 1 LVA (5' -22bp) range2175968 1 1 11 BBa_K611102_sequence 1 ctttagtagcttaataacgctgatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z