BBa_K613000 1 BBa_K613000 Medium-strength Plac promoter 2011-09-19T11:00:00Z 2015-05-08T01:12:54Z This part is the UV5 Lac promoter. The UV5 mutation is a double mutation concerning the -10 region of the promoter, which makes the consensus the -10 region of E.coli (change of TATGTT to TATAAT). The -35 region is not consensus sequence: it sequence is TTTACA, when the consensus would be TTGAC. which makes it a medium strenght promoter. This is a medium-strong Plac promoter. Placed before a gene, it promotes its expression. Plac is repressed by LacI. This promoter can be used for in vivo reporter systems; its medium strength is interesting for reporter genes that have a long half-life or that are not well supported by the cell. false false _785_ 0 9696 9 In stock false The biobrick sequence does include the -10 and -35 regions; however it doesn't include the ribosome binding site. false Nadine Guenat, Henrike Niederholtmeyer BBa_K613000_sequence 1 ggctttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaatttcacac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z