BBa_K613002 1 BBa_K613002 T7 promoter family member 2011-09-19T11:00:00Z 2015-05-08T01:12:54Z synthetic Parts K613001 through K613006 are T7 promoter variants. K613001 is the T7 promoter wildtype. The other sequences were derived by single base pair mutations that have been shown to alter its strength. The part includes a strong ribosomal binding site. Its strength was determined by cloning it in front of mRFP1 reporter and measuring fluorescence of BL21 cells containing a low copy number plasmid containing the reporter construct. false false _785_ 0 7125 9 Not in stock false Imburgio, D., Rong, M., Ma, K. & McAllister, W.T. Studies of promoter recognition and start site selection by T7 RNA polymerase using a comprehensive collection of promoter variants. Biochemistry 39, 10419???10430 (2000). false Alessandro Ferrari, Vincent Zimmern, Nadine Guenat, Henrike Niederholtmeyer annotation2135990 1 RBS range2135990 1 96 101 annotation2135991 1 T7 promoter range2135991 1 30 52 BBa_K613002_sequence 1 gaagcgagaggatcttaaggctagagtactgatacgactcactatagggagaccacaacggtttcccactagaaataattttgtttaacttaagaaggaggaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z