BBa_K613012 1 BBa_K613012 T7 promoter family member (LacI repressed) 2011-09-20T11:00:00Z 2015-05-08T01:12:54Z synthetic Parts K613007 through K613012 are T7 promoter variants containing the lac operator just downstream of the T7 promoter. K613007 contains the T7 promoter wildtype sequence. The other sequences were derived by single base pair mutations that have been shown to alter its strength. The part includes a strong ribosomal binding site. Its strength was determined by cloning it in front of mRFP1 reporter and measuring fluorescence of BL21 cells containing a low copy number plasmid containing the reporter construct. false false _785_ 0 7125 9 It's complicated false Imburgio, D., Rong, M., Ma, K. & McAllister, W.T. Studies of promoter recognition and start site selection by T7 RNA polymerase using a comprehensive collection of promoter variants. Biochemistry 39, 10419???10430 (2000). false Alessandro Ferrari, Vincent Zimmern, Nadine Guenat, Henrike Niederholtmeyer annotation2136244 1 T7 promoter range2136244 1 30 52 annotation2136246 1 RBS range2136246 1 107 112 annotation2136245 1 lac operator range2136245 1 55 75 BBa_K613012_sequence 1 gaagcgagaggatcttaaggctagagtactaatacgactcactatagggcgaggaattgtgagcggataacaattcccactagaaataattttgtttaacttaagaaggaggaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z