BBa_I746350 1 BBa_I746350 ogr activator from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The ogr activator taken from P2 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943865 1 B0034 range1943865 1 1 12 annotation1943867 1 P2 ogr range1943867 1 19 237 annotation1943866 1 P2 ogr range1943866 1 19 19 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K274370 1 BBa_K274370 PoPS -> P2 ogr - PF promoter -> PoPS 2009-10-18T11:00:00Z 2015-05-08T01:11:45Z n/a n/a false false _374_ 0 5448 9 Not in stock false n/a false Vivian Mullin component2055285 1 BBa_B0012 component2055282 1 BBa_I746350 component2055290 1 BBa_I746360 component2055283 1 BBa_B0010 annotation2055283 1 BBa_B0010 range2055283 1 246 325 annotation2055282 1 BBa_I746350 range2055282 1 1 237 annotation2055285 1 BBa_B0012 range2055285 1 334 374 annotation2055290 1 BBa_I746360 range2055290 1 383 473 BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898430 1 PolyA range1898430 1 32 39 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898428 1 B1006 range1898428 1 1 39 annotation1898431 1 PolyA range1898431 1 1 9 BBa_K614001 1 BBa_K614001 Nitrate responsive promoter with amplifier 2011-10-08T11:00:00Z 2015-05-08T01:12:54Z This is a combination of existing parts in the registry. This plasmid should amplify the signal generated by the PyeaR promoter using amplifier BBa_K274370 from Cambridge 2009. false false _786_ 0 9218 9 Not in stock false None false Steven Allen component2273782 1 BBa_K274370 component2273769 1 BBa_K216005 component2273794 1 BBa_K081014 annotation2273794 1 BBa_K081014 range2273794 1 590 1363 annotation2273769 1 BBa_K216005 range2273769 1 1 100 annotation2273782 1 BBa_K274370 range2273782 1 109 581 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_I746360 1 BBa_I746360 PF promoter from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z The original source is the P2 phage genome. For our work the DNA came from plasmids, kindly supplied to us by Prof. Calendar, University of California (Berkeley): Bacteriophage PSP3 and fR73 Activator Proteins: Analysis of Promoter Specificities; Julien and Calendar, 1996; JOURNAL OF BACTERIOLOGY, Oct. 1996, p. 5668???5675 Released HQ 2013 This is the PF promoter taken from the P2 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PF promoter. false false _116_ 0 2122 9 In stock false no special considerations seemed necessary true Stefan Milde annotation1943783 1 PF range1943783 1 1 91 BBa_K081014 1 BBa_K081014 RFP protein generator - PoPS->RFP 2008-10-18T11:00:00Z 2015-05-08T01:08:35Z RBS: RFP: T: Released HQ 2013 PoPS in -> RFP out <br> Strong RBS (efficiency=0.6). <br> Artificial 39 bp terminator (efficiency=0.99). false true _227_ 0 2583 9 In stock true We used BioBrick Standard Assembly. true Lorenzo Pasotti, Paolo Magni component2246155 1 BBa_B1006 component2246150 1 BBa_E1010 component2246146 1 BBa_B0030 annotation2246150 1 BBa_E1010 range2246150 1 22 727 annotation2246146 1 BBa_B0030 range2246146 1 1 15 annotation2246155 1 BBa_B1006 range2246155 1 736 774 BBa_K216005 1 BBa_K216005 PyeaR promoter, responsive to nitrate, nitrite and nitric oxide 2009-09-24T11:00:00Z 2015-05-08T01:11:30Z BioBricked from E. coli K-12 genomic DNA by the Edinburgh 2009 iGEM team. PyeaR promoter. This is the promoter of the Escherichia coli yeaR/yoaG operon (see Lin, H.-Y., Bledsoe, P.J., and Stewart, V. 2007. Activation of yeaR-yoaG operon transcription by the nitrate-responsive regulator NarL is independent of oxygen-responsive regulator Fnr in ''Escherichia coli'' K-12. J. Bacteriol. 189, 7539-7548). Unlike other E. coli promoters responding to nitrate and nitrite, this promoter is not repressed under aerobic conditions. false false _317_ 0 837 163 It's complicated true No special considerations. false Edinburgh iGEM 2009 annotation2027075 1 promoter -10 region range2027075 1 89 94 annotation2027072 1 NarL-binding region range2027072 1 50 65 annotation2027073 1 NsrR-binding region range2027073 1 58 80 annotation2027074 1 promoter -35 region range2027074 1 66 71 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K081014_sequence 1 attaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K614001_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacgtactagagaaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgcccgccttttctttaccggtggttgtgctgtcgattagccaaccgggacaaatagcctgacatctccggcgcaactgaaaataccacttactagagattaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K274370_sequence 1 aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgcccgccttttctttaccggtggttgtgctgtcgattagccaaccgggacaaatagcctgacatctccggcgcaactgaaaataccact BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0030_sequence 1 attaaagaggagaaa BBa_I746350_sequence 1 aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K216005_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I746360_sequence 1 ttgcccgccttttctttaccggtggttgtgctgtcgattagccaaccgggacaaatagcctgacatctccggcgcaactgaaaataccact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z