BBa_K615001 1 BBa_K615001 Zinc finger-omega subunit fusion protein 2011-09-23T11:00:00Z 2015-05-08T01:12:54Z CoDA sequences from: Jeffry D Sander, Elizabeth J Dahlborg, Mathew J Goodwin et al. Selection-free zinc-finger-nuclease engineering by contextdependent assembly (CoDA). (2011) Nature Methods 8(1): 53-55. This protein is designed for one-hybrid selection systems testing for zinc finger binding. In a strain such as BBa_K615000, where the omega subunit of RNA polymerase has been knocked out, zinc finger binding can be used to control expression of genes necessary for cell survival. Properly bound zinc fingers recruit RNA polymerase to transcribe genes such as His3, allowing the bacteria to grow in incomplete media, while improperly bound zinc fingers will not activate His3 and thus will not survive. This array is composed of three zinc fingers: Fingers 2 (F2) and 3 (F3) are known from CoDA studies, while F1 is a novel zinc finger designed to bind to the sequence TGG, together creating a zinc finger binding site of 5'-GTG GGA TGG-3'. The part is also designed to allow F1 to be easily replaced by other zinc fingers to allow testing of many different fingers' abilities to bind to the TGG codon. false false _787_ 0 10031 9 In stock false Array designed to bind to 5'-GTGGGATGG-3', of which the first six bases represents a known CoDA pair while no binders have yet been found for the last codon in the context of the other fingers. false Naomi Genuth annotation2139205 1 omega subunit range2139205 1 1 270 annotation2139209 1 F3 range2139209 1 510 578 annotation2139208 1 F2 range2139208 1 426 494 annotation2139207 1 F1 range2139207 1 338 415 BBa_K615001_sequence 1 tggcacgcgtaactgttcaggacgctgtagagaaaattggtaaccgttttgacctggtactggtcgccgcgcgtcgcgctcgtcagatgcaggtaggcggaaaggacccgctcgtaccggaagaaaacgataaaaccactgtaatcgcgctgcgcgaaatcgaagaaggtctgatcaacaaccagatcctcgacgttcgcgaacgccaggaacagcaagagcaggaagccgctgaattacaagccgttaccgctattgctgaaggtcgtgcggccgcggactacaaggatgacgacgacaagttccggaccggttccaagacacccccccatggtacgccatttcaatgtcgcatttgcatgcgcaatttctcccgtcgcgaccatttaggtgctcatattcgcactcacacgggtgaaaaaccatttcaatgccgtatttgcatgcgtaacttttcgcaatcggcccacctcaagcgtcacattcgtacgcatacgggcgagaagccatttcaatgccgtatttgcatgcgcaacttctctcgcaatactgcactccagcaccacatccgcacccactaataataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z