BBa_K618111 1 BBa_K618111 pBAD ompA-Gli1 2011-09-26T11:00:00Z 2015-05-08T01:12:54Z parts come from iGEM distribution This is a fusion between ompA and the DNA binding protein Gli-1. It should be present on the outer surface of cells and bind the Gli-! recognition sequence there. This will also allows cells to be anchored to glass slide with the DNA attached. false false _790_ 0 8977 9 It's complicated false Silver prefix on Gli-1 allowed us to fuse it to ompA in frame. false Chris Bate, Ben Park, Marc Ammerlaan component2144562 1 BBa_K103006 component2144563 1 BBa_K165007 component2144556 1 BBa_K259007 annotation2144556 1 BBa_K259007 range2144556 1 1 360 annotation2144562 1 BBa_K103006 range2144562 1 369 832 annotation2144563 1 BBa_K165007 range2144563 1 841 1365 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_K103006 1 OmpA OmpA outer membrane protein A fused to linker; displays proteins on cell surface 2008-09-13T11:00:00Z 2015-05-08T01:08:46Z One of our basic bricks used to create fusions attached to outer membrane false true _180_ 0 2582 9 In stock true true Michael Lower annotation1990002 1 SacI range1990002 1 459 464 annotation1993480 1 ATG range1993480 1 4 6 annotation1990001 1 linker range1990001 1 439 464 annotation1989999 1 NdeI range1989999 1 1 7 annotation1990000 1 OmpA range1990000 1 4 438 BBa_K165007 1 BBa_K165007 Gli-1 DNA-binding domain 2008-10-25T11:00:00Z 2015-05-08T01:10:55Z - - false false _267_ 0 2512 58 It's complicated true - false John Szymanski BBa_R0081 1 AraC O2 Inhibitor (AraC loop attachment with O2 site) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 this piece of DNA contains a "dead" part of coding region for AraC, and a functional Operator2 site. when attached to the rest of the promoter region, this part allows for the binding and loop formation that would result in repression of the araC promoter false false _1_ 0 24 7 In stock false 1) changed ATG start codon to TAG stop 2) 6 random deletions upstream of putative araC binding sites to preserve spacing for loop back (BB ends will add 6 base pairs); spacing crucial in matching up O2 and I2 binding sites (turns of DNA helix) 3) designed to attach to R0080 to enable all (positive and negative) regulatory functions, and to form "loop back" true Sara Neves (Fighting Darwins) annotation331787 1 stem_loop range331787 1 57 72 annotation331785 1 defunct araC range331785 1 1 78 annotation331786 1 stem_loop range331786 1 22 37 BBa_K259007 1 BBa_K259007 AraC Promoter fused with RBS 2009-09-08T11:00:00Z 2015-05-08T01:11:42Z The AraC promoter can be found naturally at 1.52min of the E.coli genome ([http://ecogene.org/geneinfo.php?eg_id=EG10054 EcoGene number EG10054]. The RBS was taken from the designed sequences of RBS by the Anderson family. For more information visit the original part page [http://partsregistry.org/Part:BBa_J61100 here]. This part has the arabinose regulated promoter (AraC/pBAD) upstream of a ribosome binding site. This is ideal for inserting a protein to be expressed downstream of this part as it's expression can be regulated by the presence of the concentration of arabinose in the growing environment/media of the cells. ==What this part actually does== This composite part includes the AraC/pBAD promoter and a strong ribosome binding site designed from the Anderson family of RBS. The AraC/pBAD promoter can be used with prokaryotic chassis to regulate expresion of proteins. When the AraC/pBAD promoter is placed upstream of your canditate translational unit (protein to be expressed) it allows control of the trancription of the said protein. This is done via controlling the concentration of arabinose sugar in the environment/solution of bacterial growth. Controlling the transcription will not ensure translation. The ribosome binding site is ideally placed a small distance away from the promoter site to ensure that the ribosome will bind and start translating the protein coding sequence found downstream. false false _357_ 0 5318 9 It's complicated false The part was designed with RFC10 assembly from supplied biobricks of the iGEM2009 distribution. false Petros Mina component2020547 1 BBa_J61100 component2020546 1 BBa_R0080 component2020539 1 BBa_R0081 annotation2020539 1 BBa_R0081 range2020539 1 1 183 annotation2020547 1 BBa_J61100 range2020547 1 349 360 annotation2020546 1 BBa_R0080 range2020546 1 192 340 BBa_R0080 1 AraC Promoter (AraC regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z GenBank: J01641 (www.ncbi.nlm.nih.gov) Released HQ 2013 AraC operator, truncated to include araO1, araI1, araI2, c-amp1, and c-amp2 sites. This operator should *activate* transcription in the presence of AraC; b/c the operator lacks the araO2 site, there should not be araC-mediated repression. false false _1_ 0 24 7 In stock false true Sara Neves (Fighting Darwins) annotation301462 1 ara1 and ara2 range301462 1 73 101 annotation301458 1 c-amp1 range301458 1 43 72 annotation301456 1 c-amp2 range301456 1 4 29 annotation301457 1 araO1 range301457 1 6 44 annotation308601 1 -35 range308601 1 113 118 annotation308602 1 -10 range308602 1 136 141 BBa_K103006_sequence 1 catatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctc BBa_K259007_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccattactagagaaagaggggaca BBa_J61100_sequence 1 aaagaggggaca BBa_K618111_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccattactagagaaagaggggacatactagagcatatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctctactagagaagcgtgagcctgaatctgtgtatgaaactgactgccgttgggatggctgtagccaggaatttgactcccaagagcagctggtgcaccacatcaacagcgagcacatccacggggagcggaaggagttcgtgtgccactgggggggctgctccagggagctgaggcccttcaaagcccagtacatgctggtggttcacatgcgcagacacactggcgagaagccacacaagtgcacgtttgaagggtgccggaagtcatactcacgcctcgaaaacctgaagacgcacctgcggtcacacacgggtgagaagccatacatgtgtgagcacgagggctgtagtaaagccttcagcaatgccagtgaccgagccaagcaccagaatcggacccattccaatgagaagccgtatgtatgtaagctccctggctgcaccaaacgctatacagatcctagctcgctgcgaaaacatgtcaagacagtgcatggtcctgacgcccatgtgaccaaacggcaccgtggggat BBa_R0081_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaac BBa_K165007_sequence 1 aagcgtgagcctgaatctgtgtatgaaactgactgccgttgggatggctgtagccaggaatttgactcccaagagcagctggtgcaccacatcaacagcgagcacatccacggggagcggaaggagttcgtgtgccactgggggggctgctccagggagctgaggcccttcaaagcccagtacatgctggtggttcacatgcgcagacacactggcgagaagccacacaagtgcacgtttgaagggtgccggaagtcatactcacgcctcgaaaacctgaagacgcacctgcggtcacacacgggtgagaagccatacatgtgtgagcacgagggctgtagtaaagccttcagcaatgccagtgaccgagccaagcaccagaatcggacccattccaatgagaagccgtatgtatgtaagctccctggctgcaccaaacgctatacagatcctagctcgctgcgaaaacatgtcaagacagtgcatggtcctgacgcccatgtgaccaaacggcaccgtggggat BBa_R0080_sequence 1 gcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z