BBa_R0080 1 AraC Promoter (AraC regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z GenBank: J01641 (www.ncbi.nlm.nih.gov) Released HQ 2013 AraC operator, truncated to include araO1, araI1, araI2, c-amp1, and c-amp2 sites. This operator should *activate* transcription in the presence of AraC; b/c the operator lacks the araO2 site, there should not be araC-mediated repression. false false _1_ 0 24 7 In stock false true Sara Neves (Fighting Darwins) annotation301457 1 araO1 range301457 1 6 44 annotation308601 1 -35 range308601 1 113 118 annotation301456 1 c-amp2 range301456 1 4 29 annotation301458 1 c-amp1 range301458 1 43 72 annotation301462 1 ara1 and ara2 range301462 1 73 101 annotation308602 1 -10 range308602 1 136 141 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_R0081 1 AraC O2 Inhibitor (AraC loop attachment with O2 site) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 this piece of DNA contains a "dead" part of coding region for AraC, and a functional Operator2 site. when attached to the rest of the promoter region, this part allows for the binding and loop formation that would result in repression of the araC promoter false false _1_ 0 24 7 In stock false 1) changed ATG start codon to TAG stop 2) 6 random deletions upstream of putative araC binding sites to preserve spacing for loop back (BB ends will add 6 base pairs); spacing crucial in matching up O2 and I2 binding sites (turns of DNA helix) 3) designed to attach to R0080 to enable all (positive and negative) regulatory functions, and to form "loop back" true Sara Neves (Fighting Darwins) annotation331786 1 stem_loop range331786 1 22 37 annotation331787 1 stem_loop range331787 1 57 72 annotation331785 1 defunct araC range331785 1 1 78 BBa_K103006 1 OmpA OmpA outer membrane protein A fused to linker; displays proteins on cell surface 2008-09-13T11:00:00Z 2015-05-08T01:08:46Z One of our basic bricks used to create fusions attached to outer membrane false true _180_ 0 2582 9 In stock true true Michael Lower annotation1990001 1 linker range1990001 1 439 464 annotation1990002 1 SacI range1990002 1 459 464 annotation1989999 1 NdeI range1989999 1 1 7 annotation1993480 1 ATG range1993480 1 4 6 annotation1990000 1 OmpA range1990000 1 4 438 BBa_K618112 1 BBa_K618112 pBAD ompA-zif268 2011-09-26T11:00:00Z 2015-05-08T01:12:54Z parts come from iGEM distribution and from iGEM HQ This is a fusion between ompA and the DNA binding protein zif268 under the control of pBAD. The protein should be present on the outer surface of cells and bind the zif268 recognition sequence (GATGCTGCA). This will also allow cells to be anchored to a glass slide with the appropriate DNA attached. This can serve as a way to position cells in any desired pattern. false false _790_ 0 8977 9 It's complicated false NOTE- the sequence as listed here is wrong. Because part K165006 is supplied on a Silver lab vector (Bba_J63010) with a modified biobrick prefix, the scar between ompA and zif268 is non-standard. The G at position 840 is not there. This has been verified by sequencing. Deleting the G keeps zif268 in frame with ompA. Part length is 1364bp. The sequence was generated automatically and I couldn't figure out how to edit it. false Chris Bate, Ben Park, Marc Ammerlaan component2144955 1 BBa_K103006 component2144956 1 BBa_K165006 component2144949 1 BBa_K259007 annotation2144956 1 BBa_K165006 range2144956 1 841 1092 annotation2144955 1 BBa_K103006 range2144955 1 369 832 annotation2144949 1 BBa_K259007 range2144949 1 1 360 BBa_K165006 1 BBa_K165006 Zif268-HIV DNA-binding domain 2008-10-25T11:00:00Z 2015-05-08T01:10:55Z - - false false _267_ 0 2512 58 It's complicated true - false John Szymanski BBa_K259007 1 BBa_K259007 AraC Promoter fused with RBS 2009-09-08T11:00:00Z 2015-05-08T01:11:42Z The AraC promoter can be found naturally at 1.52min of the E.coli genome ([http://ecogene.org/geneinfo.php?eg_id=EG10054 EcoGene number EG10054]. The RBS was taken from the designed sequences of RBS by the Anderson family. For more information visit the original part page [http://partsregistry.org/Part:BBa_J61100 here]. This part has the arabinose regulated promoter (AraC/pBAD) upstream of a ribosome binding site. This is ideal for inserting a protein to be expressed downstream of this part as it's expression can be regulated by the presence of the concentration of arabinose in the growing environment/media of the cells. ==What this part actually does== This composite part includes the AraC/pBAD promoter and a strong ribosome binding site designed from the Anderson family of RBS. The AraC/pBAD promoter can be used with prokaryotic chassis to regulate expresion of proteins. When the AraC/pBAD promoter is placed upstream of your canditate translational unit (protein to be expressed) it allows control of the trancription of the said protein. This is done via controlling the concentration of arabinose sugar in the environment/solution of bacterial growth. Controlling the transcription will not ensure translation. The ribosome binding site is ideally placed a small distance away from the promoter site to ensure that the ribosome will bind and start translating the protein coding sequence found downstream. false false _357_ 0 5318 9 It's complicated false The part was designed with RFC10 assembly from supplied biobricks of the iGEM2009 distribution. false Petros Mina component2020539 1 BBa_R0081 component2020546 1 BBa_R0080 component2020547 1 BBa_J61100 annotation2020539 1 BBa_R0081 range2020539 1 1 183 annotation2020546 1 BBa_R0080 range2020546 1 192 340 annotation2020547 1 BBa_J61100 range2020547 1 349 360 BBa_K103006_sequence 1 catatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctc BBa_K165006_sequence 1 cccttccagtgtcgcatttgcatgcggaacttttcgctcaggacggaccttgacaggcatacccgtactcataccggtgaaaaaccgtttcagtgtcggatctgtatgcgaaatttctccctcagccagaccttgcgccgccatctacgtacgcacaccggcgagaagccattccaatgccgaatatgcatgcgcaacttcagtctcaggagcaacctggggcggcacctaaaaacccacacaggagaaaaa BBa_K259007_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccattactagagaaagaggggaca BBa_K618112_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccattactagagaaagaggggacatactagagcatatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctctactagagcccttccagtgtcgcatttgcatgcggaacttttcgctcaggacggaccttgacaggcatacccgtactcataccggtgaaaaaccgtttcagtgtcggatctgtatgcgaaatttctccctcagccagaccttgcgccgccatctacgtacgcacaccggcgagaagccattccaatgccgaatatgcatgcgcaacttcagtctcaggagcaacctggggcggcacctaaaaacccacacaggagaaaaa BBa_J61100_sequence 1 aaagaggggaca BBa_R0081_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaac BBa_R0080_sequence 1 gcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z