BBa_K619888 1 BBa_K619888 RNA Thermometer or thermosensor (30-37 Celsius) 2011-09-23T11:00:00Z 2015-05-08T01:12:54Z Based on genomic sequence from Listeria monocytogenes. See: "An RNA Thermosensor Controls Expression of Virulence Genes in Listeria monocytogenes." Cell, Vol. 110, pp 551???561 This mRNA thermometer melts between 30 and 37 degrees Celsius in E. coli. It contains a Shine-Dalgarno sequence that has been optimized for E. coli as well as a start codon. When it has not been heat-activated, the mRNA forms a hairpin structure, hiding the SD and ATG hidden from ribosomes, so that the downstream gene(s) will not be expressed. This sequence is nearly identical to the thermosensor sequence found in Listeria monocytogenes. We have other thermoswitch BioBrick parts with smaller temperature ranges that can be found in the Part Registry. false false _791_ 0 8407 9 Not in stock false We modified the SD sequence to work better in E. coli. false Chet Chamberlain BBa_K619888_sequence 1 tttagcgtgactttctttcaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggaggatgagacatgaacgctcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z